1 What is bioinformatics?

Quick and dirty definition

Bioinformatics is the application of computer technology to the management of biological information. bioplanet.com

World-of-sequences definition

The mathematical, statistical and computing methods that aim to solve biological problems using DNA and amino acid sequences and related information. Fredj Tekaia (Pasteur Institute)

Complete definition

Bioinformatics is an interdisciplinary field that develops methods and software tools for understanding biological data [...] combines computer science, statistics, mathematics and engineering to study and process biological data. wikipedia

Main research fields

• Genomics (sequences)
• Structural bioinformatics (structures)

2 What is a DNA sequence?

Nucleotides ...

... can assemble into a polymer called DNA ...

... with a 3D structure ...

... that could be cast to string!

>gi|176120924|ref|NC_001417.2| Enterobacterio phage MS2, complete genome
GGGTGGGACCCCTTTCGGGGTCCTGCTCAACTTCCTGTCGAGCTAATGCCATTTTTAATGTCTTTAGCGA
GACGCTACCATGGCTATCGCTGTAGGTAGCCGGAATTCCATTCCTAGGAGGTTTGACCTGTGCGAGC...

3 What is a protein?

RNA transcription

Protein synthesis

Protein 3D structure

Mechanosensitive channel in a lipid bilayer.

4 Can we assemble a whole genome from small DNA sequences?

Genome sequencing

• (Next Generation) sequencing technologies provide 'reads' of short sequences of DNA
• Reads are generated from random locations across the entire genome
• De novo assembling techniques have been developed to tackle this problem

Genome assembly

5 Can we predict protein structure from sequence?

Protein structure prediction

Six Microseconds of Protein Folding Source: https://www.youtube.com/watch?v=sD6vyfTtE4U

6 Can we predict protein function from sequence?

The protein structure-function paradigm

Heavily debated, but:

Function requires structure.

Protein function prediction

• Homology-based methods
• Sequence motif based methods
• Structure based methods

7 Can we predict protein stability after a sequence mutation?

Mutation impact on protein stability

• A single change in a protein sequence may have drastic consequences... or not
• May explain the cause of a particular disease
• It's a matter of ΔΔG prediction

8 Can we predict protein-protein interactions from structures?

Source: https://www.youtube.com/watch?v=Ms_ehUVvKKk

9 Can we design small molecules in silico to inhibit protein activity?

Computational Drug Design

Source: https://www.youtube.com/watch?v=TTtrk0Ue-Cg

10 Does Jon Snow die in the next Game Of Thrones season?

Someone knows.

Richard Vale, Bayesian Prediction For The Winds Of Winter, arXiv, sept. 2014

Conclusion

Bioinformatics is now part of biology...

... but the cool part of biology.